DNA & RNA Reverse Complement Tool

Generate a reverse complement, complement, or reverse sequence using standard IUPAC nucleotide codes.

How to use this tool

Enter one or more DNA or RNA sequences as plain text or FASTA, then choose the operation you need. Each FASTA record is processed independently.

Reverse complement: Reverses the sequence and replaces every nucleotide with its complementary code.
Reverse: Reads the sequence from last character to first without changing its codes.
Complement: Replaces each nucleotide with its complement while preserving sequence order.
IUPAC codes: Supports R↔Y, K↔M, B↔V, D↔H, S, W, N, and the gap characters - and .
Molecule type: Auto detects T as DNA and U as RNA. Select DNA or RNA when a sequence contains neither.
Browser limits: Accepts up to 1,000,000 sequence characters, 1,000 FASTA records, and 1,000 characters per header.
FASTA files: Load a local FASTA file to inspect, edit, validate, and transform its records without uploading it.

DNA uses A↔T; RNA uses A↔U. Do not mix T and U within one record. Preserve the original letter case or convert output to uppercase or lowercase.

Complement vs. reverse complement orientation

Original strand, 5′ → 3′GATTACA

Complementary strand, 3′ → 5′CTAATGT

Reverse complement, 5′ → 3′TGTAATC

A complement replaces each base while preserving character order, so it represents the aligned antiparallel strand from 3′ → 5′. A reverse complement also reverses that order and is conventionally reported 5′ → 3′.

Enter Nucleic Acid Sequence

DNA or RNA Sequence

Load FASTA FileNo file selected

Molecule type

Length: 0Valid: —

Try an example:

This tool accepts up to 1,000,000 sequence characters and 1,000 FASTA records. These limits help prevent browser slowdowns, especially on mobile devices. Split larger datasets into smaller batches.

Select Transformation

Result

DNA: A↔T | RNA: A↔U | IUPAC ambiguity codes supported

Reverse complement questions, answered

What is the difference between a complement and a reverse complement?

A complement substitutes each base in the same character order and represents the antiparallel strand 3′ → 5′. A reverse complement reverses that complementary sequence so the same strand is written in the standard 5′ → 3′ direction.

Should a PCR reverse primer be complemented or reverse-complemented?

Reverse-complement the downstream target region shown 5′ → 3′ on the forward (plus) strand. The resulting 5′ → 3′ sequence is the reverse primer to order.

Does RNA mode produce RNA or cDNA?

RNA mode returns an RNA complement containing U. It does not perform reverse transcription and does not generate DNA or cDNA.

How it works

What is a nucleic acid reverse complement?

A reverse complement is formed by two operations: first the sequence is reversed, then each base is replaced with its Watson-Crick complement. DNA uses thymine (A↔T), RNA uses uracil (A↔U), and cytosine pairs with guanine (C↔G) in both.

The result represents the complementary strand written in the conventional 5′ → 3′ direction.

IUPAC ambiguity codes are complemented as groups: R↔Y, K↔M, B↔V, and D↔H. The self-complementary codes S, W, and N remain unchanged, as do the gap characters - and .

Supported nucleotide and gap symbols
Code	Represents	Complement
A	Adenine	T (DNA) or U (RNA)
C	Cytosine	G
G	Guanine	C
T / U	Thymine / Uracil	A
R	A or G	Y
Y	C or T/U	R
S	G or C	S
W	A or T/U	W
K	G or T/U	M
M	A or C	K
B	C, G, or T/U	V
D	A, G, or T/U	H
H	A, C, or T/U	D
V	A, C, or G	B
N	Any base	N
. / -	Gap	Unchanged

Original 5′ → 3′G A T T A C AReversed 3′ → 5′A C A T T A GReverse complement 5′ → 3′T G T A A T C

Sequence easter egg: Gattaca

Using a reverse complement for PCR primers

PCR primers are ordered and reported 5′ → 3′. When a downstream target region is displayed 5′ → 3′ on the forward (plus) strand, the sequence ordered as the reverse primer is that region's reverse complement, written 5′ → 3′.

Displayed forward strand region 5′ → 3′GATTACAGCTTAGCCTACGAReverse primer sequence 5′ → 3′TCGTAGGCTAAGCTGTAATC

In this worked example, the downstream region GATTACAGCTTAGCCTACGA becomes the reverse primer TCGTAGGCTAAGCTGTAATC. This operation establishes sequence orientation only; it does not evaluate primer specificity, melting temperature, GC content, dimers, or hairpins.

What is a complement without reversing?

A complement replaces every base with its Watson-Crick partner without changing the input order. For a 5′ → 3′ input sequence, the aligned complement is the opposite strand written 3′ → 5′.

Original 5′ → 3′G A T T A C AComplement 3′ → 5′C T A A T G T

What is a reverse without complementing?

A reverse reads the original sequence backwards, from the last base to the first, without changing any bases. This is less often biologically meaningful by itself, but it can help when checking sequence orientation or palindromes.

Original 5′ → 3′G A T T A C AReversed 3′ → 5′A C A T T A G